About   Help   FAQ
Acy1em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Acy1em1(IMPC)J
Name: aminoacylase 1; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5784639
Synonyms: Acy1em1J
Gene: Acy1  Location: Chr9:106310180-106315518 bp, - strand  Genetic Position: Chr9, 57.49 cM
Alliance: Acy1em1(IMPC)J page
IMPC: Acy1 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Not Specified
 
Mutation detailsThis allele from project Acy1-7841J-M3824 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GACAAAGTGTCCCCAACCCA, CTGGAGCCTTGAGCAGGGTG, CTGCTTTTGCTGGTACCCAC and TATACATCTCTGGGCTGCCT, which resulted in a 214 bp deletion around exon 3 beginning at Chromosome 9 negative strand position 106,437,075 bp, GAACGCAGATGCAGATGTTT, and ending after TGGAGCCTTGAGCAGGGTGG at 106,436,862 bp (GRCm38/mm10). This mutation deletes exon 3 and 150 bp of flanking intronic sequence including the splice acceptor and donor, in addition there is another 23 bp deletion (ggttggggacactttgtcccctg) in intron 4, 7 bp after the 214 bp deletion, that will not alter the result of the 214 bp deletion. This mutation is predicted to cause a change of amino acid sequence after residue 34 and early truncation 40 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 3 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Acy1 Mutation:  33 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  5 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
09/30/2025
MGI 6.24
The Jackson Laboratory