About   Help   FAQ
Krt90em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Krt90em1(IMPC)J
Name: keratin 90; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5784550
Synonyms: Krt90em1J
Gene: Krt90  Location: Chr15:101460791-101471385 bp, - strand  Genetic Position: Chr15, 56.9 cM
Alliance: Krt90em1(IMPC)J page
IMPC: Krt90 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Not Specified
 
Mutation detailsThis allele from project Krt90-7840J-M3816 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GCTCTGGGCCACATAGATGG, TAGAGAACTGCTGAATTCAG, GGACACCCAATAAATAGTAA and CTGAGTTTGGGGGTCATGCA, which resulted in a 327 bp deletion around exon 2 beginning at Chromosome 15 negative strand position 101,560,724 bp, GCAGGGTCCCTTACTATTTA, and ending after AGTGAGTGGGTCCTCCATCT at 101,560,398 bp (GRCm38/mm10). This mutation deletes exon 2 and 118 bp of flanking intronic sequence including the splice acceptor and donor, in addition there is a 4 bp insertion (acag) and a 22 bp deletion (gaattcagcagttctctacatc) 71 bp after the 327 bp deletion that should not alter the results of the 327 bp deletion. This mutation is predicted to cause a change of amino acid sequence after residue 162 and early truncation 11 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Krt90 Mutation:  29 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory