Krt90em1(IMPC)J
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Krt90em1(IMPC)J |
| Name: |
keratin 90; endonuclease-mediated mutation 1, Jackson |
| MGI ID: |
MGI:5784550 |
| Synonyms: |
Krt90em1J |
| Gene: |
Krt90 Location: Chr15:101460791-101471385 bp, - strand Genetic Position: Chr15, 56.9 cM
|
| Alliance: |
Krt90em1(IMPC)J page
|
| IMPC: |
Krt90 gene page |
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Not Specified
|
| |
|
Mutation details: This allele from project Krt90-7840J-M3816 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GCTCTGGGCCACATAGATGG, TAGAGAACTGCTGAATTCAG, GGACACCCAATAAATAGTAA and CTGAGTTTGGGGGTCATGCA, which resulted in a 327 bp deletion around exon 2 beginning at Chromosome 15 negative strand position 101,560,724 bp, GCAGGGTCCCTTACTATTTA, and ending after AGTGAGTGGGTCCTCCATCT at 101,560,398 bp (GRCm38/mm10). This mutation deletes exon 2 and 118 bp of flanking intronic sequence including the splice acceptor and donor, in addition there is a 4 bp insertion (acag) and a 22 bp deletion (gaattcagcagttctctacatc) 71 bp after the 327 bp deletion that should not alter the results of the 327 bp deletion. This mutation is predicted to cause a change of amino acid sequence after residue 162 and early truncation 11 amino acids later.
(J:188991)
|
| Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
| Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
| All: |
3 reference(s) |
|