Fam120a^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Fam120a^em1(IMPC)J
• Name: family with sequence similarity 120, member A; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5781315
• Synonyms: Fam120a^em1J
• Gene: Fam120a Location: Chr13:49032695-49121493 bp, - strand Genetic Position: Chr13, 25.0 cM
• Alliance: Fam120a^em1(IMPC)J page
• IMPC: Fam120a gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Not Specified
• Mutation details: This allele from project Fam120a-7754J-M691 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TTCAAAAGATAGATAATGTC, GCTCTTCACTTGCACTCTCT, GGAGCAGTGTGTCACATGAT and AGTAGCTCTTTAAAGATGTC, which resulted in a 504 bp deletion around exon 2 beginning at Chromosome 13 negative strand position 48,949,451 bp, ATGATTGGTCCTGGCACTTT, and ending after TGGGCTCTTCACTTGCACTC at 48,948,948 bp (GRCm38/mm10). This mutation deletes exon 2 and 257 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 158 and early truncation 26 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

4 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Fam120a Mutation: 55 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)