About   Help   FAQ
Fam120aem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Fam120aem1(IMPC)J
Name: family with sequence similarity 120, member A; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5781315
Synonyms: Fam120aem1J
Gene: Fam120a  Location: Chr13:49032695-49121493 bp, - strand  Genetic Position: Chr13, 25.0 cM
Alliance: Fam120aem1(IMPC)J page
IMPC: Fam120a gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Not Specified
 
Mutation detailsThis allele from project Fam120a-7754J-M691 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TTCAAAAGATAGATAATGTC, GCTCTTCACTTGCACTCTCT, GGAGCAGTGTGTCACATGAT and AGTAGCTCTTTAAAGATGTC, which resulted in a 504 bp deletion around exon 2 beginning at Chromosome 13 negative strand position 48,949,451 bp, ATGATTGGTCCTGGCACTTT, and ending after TGGGCTCTTCACTTGCACTC at 48,948,948 bp (GRCm38/mm10). This mutation deletes exon 2 and 257 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 158 and early truncation 26 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 5 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Fam120a Mutation:  55 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
10/07/2025
MGI 6.24
The Jackson Laboratory