About   Help   FAQ
Telo2em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Telo2em1(IMPC)J
Name: telomere maintenance 2; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5781312
Synonyms: Telo2em1J
Gene: Telo2  Location: Chr17:25318544-25334941 bp, - strand  Genetic Position: Chr17, 12.53 cM, cytoband A3.3
Alliance: Telo2em1(IMPC)J page
IMPC: Telo2 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Not Specified
 
Mutation detailsThis allele from project Telo2-7804J-9704M was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CTCTTCTCAGAAATGTGGCG, CCATGAGAGATGTCGAGGCA, AAGGCAACACTAGGCAGAGG and CAACACTAGGCAGAGGGGGG, which resulted in a 465 bp deletion around exon 3 beginning at Chromosome 17 negative strand position 25,113,380 bp, GGCTTATTTTACCACTGAGC, and ending after CTTCTCTTCTCAGAAATGTG at 25,112,916 bp (GRCm38/mm10). This mutation deletes exon 3 and 187 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is an insertion of two bp (AA) at the site of the mutation that will not effect the result of the deletion. This mutation is predicted to cause a change of amino acid sequence after residue 112 and early truncation 55 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Telo2 Mutation:  30 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/06/2026
MGI 6.24
The Jackson Laboratory