C1qc^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: C1qc^em1(IMPC)J
• Name: complement component 1, q subcomponent, C chain; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5779860
• Synonyms: C1qc^em1J
• Gene: C1qc Location: Chr4:136617115-136620225 bp, - strand Genetic Position: Chr4, 69.05 cM
• Alliance: C1qc^em1(IMPC)J page
• IMPC: C1qc gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutations: Insertion, Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory using Cas9 and guides with spacer sequences ACTCGCACACTAGCTGCTAC, AGATAGCTCTGCCCAGGTGG, GACATGATAGGGCAGAAGGC, and GGGTGTTCGTGCCGAGTGAA that targeted exon(s) ENSMUSE00000259813.7. This resulted in deletion(s) of 5 bp (location: Chr4:136616940-136616944; GRCm39), 989 bp (location: Chr4:136617034-136618022; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

3 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any C1qc Mutation: 15 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 6 reference(s)