C1qcem1(IMPC)J
Endonuclease-mediated Allele Detail
|
Symbol: |
C1qcem1(IMPC)J |
Name: |
complement component 1, q subcomponent, C chain; endonuclease-mediated mutation 1, Jackson |
MGI ID: |
MGI:5779860 |
Synonyms: |
C1qcem1J |
Gene: |
C1qc Location: Chr4:136617112-136620242 bp, - strand Genetic Position: Chr4, 69.05 cM
|
Alliance: |
C1qcem1(IMPC)J page
|
IMPC: |
C1qc gene page |
|
Strain of Origin: |
C57BL/6NJ
|
Project Collection: |
IMPC
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutations: |
|
Insertion, Intragenic deletion
|
|
|
Mutation details: This allele from project C1qc-7743J-M6896 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GGGTGTTCGTGCCGAGTGAA, ACTCGCACACTAGCTGCTAC, GACATGATAGGGCAGAAGGC and AGATAGCTCTGCCCAGGTGG, which resulted in a 989 bp deletion in exon 3 beginning at Chromosome 4 negative strand position 136,890,711 bp, CCTGGGCAGAGCTATCTGGA, and ending after GGGTGTTCGTGCCGAGTGAA at 136,889,723 bp (GRCm38/mm10). This mutation deletes exon 3 and 193 bp of flanking intronic sequence including the splice acceptor and donor. In addition, there is a single bp insertion (A) and 5 bp deletion (ggagc) 89 bp after the 989 bp deletion that are not predicted alter the results of the mutation. If read through after exon 2 occurs, a change of amino acid sequence after residue 62 and early truncation 28 amino acids later is predicted.
(J:188991)
|
Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
All: |
4 reference(s) |
|