About   Help   FAQ
C1qcem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: C1qcem1(IMPC)J
Name: complement component 1, q subcomponent, C chain; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5779860
Synonyms: C1qcem1J
Gene: C1qc  Location: Chr4:136617112-136620242 bp, - strand  Genetic Position: Chr4, 69.05 cM
Alliance: C1qcem1(IMPC)J page
IMPC: C1qc gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutations:    Insertion, Intragenic deletion
 
Mutation detailsThis allele from project C1qc-7743J-M6896 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GGGTGTTCGTGCCGAGTGAA, ACTCGCACACTAGCTGCTAC, GACATGATAGGGCAGAAGGC and AGATAGCTCTGCCCAGGTGG, which resulted in a 989 bp deletion in exon 3 beginning at Chromosome 4 negative strand position 136,890,711 bp, CCTGGGCAGAGCTATCTGGA, and ending after GGGTGTTCGTGCCGAGTGAA at 136,889,723 bp (GRCm38/mm10). This mutation deletes exon 3 and 193 bp of flanking intronic sequence including the splice acceptor and donor. In addition, there is a single bp insertion (A) and 5 bp deletion (ggagc) 89 bp after the 989 bp deletion that are not predicted alter the results of the mutation. If read through after exon 2 occurs, a change of amino acid sequence after residue 62 and early truncation 28 amino acids later is predicted. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 2 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any C1qc Mutation:  13 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  4 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
04/16/2024
MGI 6.23
The Jackson Laboratory