About   Help   FAQ
Tuba8em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Tuba8em1(IMPC)J
Name: tubulin, alpha 8; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5779854
Synonyms: Tuba8em1J
Gene: Tuba8  Location: Chr6:121187655-121203813 bp, + strand  Genetic Position: Chr6, 57.15 cM, cytoband F1
Alliance: Tuba8em1(IMPC)J page
IMPC: Tuba8 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Tuba8-7807J-M772 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TACATCACCCCACAAACAGG, TTCCTCACATCCAATGCACA, GCTCCCCAAGGAGCTAAGAG and TGGCCAAGAGAGCATTCTGC, which resulted in a 480 bp deletion including exon 2 beginning at Chromosome 6 positive strand position 121,220,250 bp, CACCTCCTGTTTGTGGGGTG, and ending after CTCCGTGAGACCTCTCTTAG at 121,220,729 bp (GRCm38/mm10). This mutation deletes exon 2 and 257 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 1 and early truncation 16 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 3 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Tuba8 Mutation:  28 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  4 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory