Tuba8em1(IMPC)J
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Tuba8em1(IMPC)J |
| Name: |
tubulin, alpha 8; endonuclease-mediated mutation 1, Jackson |
| MGI ID: |
MGI:5779854 |
| Synonyms: |
Tuba8em1J |
| Gene: |
Tuba8 Location: Chr6:121187655-121203813 bp, + strand Genetic Position: Chr6, 57.15 cM, cytoband F1
|
| Alliance: |
Tuba8em1(IMPC)J page
|
| IMPC: |
Tuba8 gene page |
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele from project Tuba8-7807J-M772 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TACATCACCCCACAAACAGG, TTCCTCACATCCAATGCACA, GCTCCCCAAGGAGCTAAGAG and TGGCCAAGAGAGCATTCTGC, which resulted in a 480 bp deletion including exon 2 beginning at Chromosome 6 positive strand position 121,220,250 bp, CACCTCCTGTTTGTGGGGTG, and ending after CTCCGTGAGACCTCTCTTAG at 121,220,729 bp (GRCm38/mm10). This mutation deletes exon 2 and 257 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 1 and early truncation 16 amino acids later.
(J:188991)
|
| Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
|
|
| Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
| All: |
4 reference(s) |
|