About   Help   FAQ
Wdr45em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Wdr45em1(IMPC)J
Name: WD repeat domain 45; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5779851
Synonyms: Wdr45em1J
Gene: Wdr45  Location: ChrX:7588212-7594439 bp, + strand  Genetic Position: ChrX, 3.48 cM
Alliance: Wdr45em1(IMPC)J page
IMPC: Wdr45 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Wdr45-7725J-M3004 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GGTTGGCAAGACCAAAGTTT, CAAGTGGTTGAGATCCTGTG, GGGCAACTGCCAGCGAGGCG and GAGGTTACCTTACTTGTTGT, which resulted in a 252 bp deletion in exon 5 beginning at Chromosome X positive strand position 7,725,839 bp, GTGGTTGAGATCCTGTGAGG, and ending after GCAGGAAGTTCCCACAACAA at 7,726,090 bp (GRCm38/mm10). This mutation deletes exon 5 and 146 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a 5 bp deletion (ctcgc) 46 bp after the 252 bp deletion that will not alter the results of the 252 bp deletion, which is predicted to cause a change of amino acid sequence after residue 78 and early truncation 2 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 3 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Wdr45 Mutation:  20 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
10/07/2025
MGI 6.24
The Jackson Laboratory