About   Help   FAQ
Ap2b1em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Ap2b1em1(IMPC)J
Name: adaptor-related protein complex 2, beta 1 subunit; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5776619
Synonyms: Ap2b1em1J
Gene: Ap2b1  Location: Chr11:83189850-83295861 bp, + strand  Genetic Position: Chr11, 50.3 cM, cytoband B5
Alliance: Ap2b1em1(IMPC)J page
IMPC: Ap2b1 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intergenic deletion
 
Mutation detailsThis allele from project Ap2b1-7740J-M6562 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences ACAAGGCAGCCACTGAAGTA, TTGCAATATAAAATACCATC, GTAAGGGCTGACTGTCCATA and AAGGGCTGACTGTCCATAGG, which resulted in a 247 bp deletion of exon 3 beginning at Chromosome 11 positive strand position 83,316,316 bp, CTTACTTCAGTGGCTGCCTT, and ending after CCCCCCTATGGACAGTCAGC at 83,316,562 bp (GRCm38/mm10). This mutation deletes exon 3 and 141 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 12 and early truncation 7 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Ap2b1 Mutation:  74 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
05/12/2026
MGI 6.24
The Jackson Laboratory