Cxxc4^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Cxxc4^em1(IMPC)J
• Name: CXXC finger 4; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5776370
• Synonyms: Cxxc4^em1J
• Gene: Cxxc4 Location: Chr3:133942245-133967922 bp, + strand Genetic Position: Chr3, 62.12 cM
• Alliance: Cxxc4^em1(IMPC)J page
• IMPC: Cxxc4 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Cxxc4-7605J-M4523 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CCGGAGGCCCCGGGCTTGC, CGCGTTGTCGCAGTTCCACG, AGATAATGAATCTCCCCGAG and AACACTGCAGACCTTTGGCG, which resulted in a 692 bp deletion in exon 3 beginning at Chromosome 3 positive strand position 134,239,753 bp, CTTGTGGATTACAACTCGGA, and ending after CTTCACTCCCCCGCAGCAGC at 134,240,444 bp (GRCm38/mm10). In addition there is another 19 bp deletion (CCGGAGGCCCCGGGCTTGC) 38 bp before the 692 bp deletion which together result in a total of 711 bp deleted from exon 3. This mutation is predicted to cause a change of amino acid sequence after residue 13 and early truncation 9 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Cxxc4 Mutation: 13 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)