About   Help   FAQ
Cxxc4em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Cxxc4em1(IMPC)J
Name: CXXC finger 4; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5776370
Synonyms: Cxxc4em1J
Gene: Cxxc4  Location: Chr3:133942245-133967922 bp, + strand  Genetic Position: Chr3, 62.12 cM
Alliance: Cxxc4em1(IMPC)J page
IMPC: Cxxc4 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Cxxc4-7605J-M4523 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CCGGAGGCCCCGGGCTTGC, CGCGTTGTCGCAGTTCCACG, AGATAATGAATCTCCCCGAG and AACACTGCAGACCTTTGGCG, which resulted in a 692 bp deletion in exon 3 beginning at Chromosome 3 positive strand position 134,239,753 bp, CTTGTGGATTACAACTCGGA, and ending after CTTCACTCCCCCGCAGCAGC at 134,240,444 bp (GRCm38/mm10). In addition there is another 19 bp deletion (CCGGAGGCCCCGGGCTTGC) 38 bp before the 692 bp deletion which together result in a total of 711 bp deleted from exon 3. This mutation is predicted to cause a change of amino acid sequence after residue 13 and early truncation 9 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Cxxc4 Mutation:  13 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
08/05/2025
MGI 6.24
The Jackson Laboratory