About   Help   FAQ
Arhgap8em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Arhgap8em1(IMPC)J
Name: Rho GTPase activating protein 8; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5776203
Synonyms: Arhgap8em1J
Gene: Arhgap8  Location: Chr15:84604253-84656408 bp, + strand  Genetic Position: Chr15, 39.99 cM
Alliance: Arhgap8em1(IMPC)J page
IMPC: Arhgap8 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Arhgap8-7741J-M2582 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences ACTCCCTCAATCATAAGCCA, GGGCGTCGCCTACCTCCCCT, CCTGCTCTCCAGGACAGACG and CATGCATCTGCCTCCCCACG, which resulted in a 288 bp deletion in exon 3 beginning at Chromosome 15 positive strand position 84,740,649 bp, GGCTTATGATTGAGGGAGTCC, and ending after GGGGAAACTCCCTCCACCAG at 84,740,936 bp (GRCm38/mm10). This mutation deletes exon 3 and 200 bp of flanking intronic sequence including the splice acceptor and donor. There is an additional 20 bp deletion 59 bp before the 288 bp deletion that will not affect the results of the mutation. The deletion of exon 3 is predicted to cause a change of amino acid sequence after residue 27 and early truncation 1 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Arhgap8 Mutation:  31 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory