Arhgap8^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Arhgap8^em1(IMPC)J
• Name: Rho GTPase activating protein 8; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5776203
• Synonyms: Arhgap8^em1J
• Gene: Arhgap8 Location: Chr15:84604253-84656408 bp, + strand Genetic Position: Chr15, 39.99 cM
• Alliance: Arhgap8^em1(IMPC)J page
• IMPC: Arhgap8 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Arhgap8-7741J-M2582 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences ACTCCCTCAATCATAAGCCA, GGGCGTCGCCTACCTCCCCT, CCTGCTCTCCAGGACAGACG and CATGCATCTGCCTCCCCACG, which resulted in a 288 bp deletion in exon 3 beginning at Chromosome 15 positive strand position 84,740,649 bp, GGCTTATGATTGAGGGAGTCC, and ending after GGGGAAACTCCCTCCACCAG at 84,740,936 bp (GRCm38/mm10). This mutation deletes exon 3 and 200 bp of flanking intronic sequence including the splice acceptor and donor. There is an additional 20 bp deletion 59 bp before the 288 bp deletion that will not affect the results of the mutation. The deletion of exon 3 is predicted to cause a change of amino acid sequence after residue 27 and early truncation 1 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Arhgap8 Mutation: 33 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)