About   Help   FAQ
Ano8em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Ano8em1(IMPC)J
Name: anoctamin 8; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5776201
Synonyms: Ano8em1J
Gene: Ano8  Location: Chr8:71928663-71938607 bp, - strand  Genetic Position: Chr8, 34.43 cM
Alliance: Ano8em1(IMPC)J page
IMPC: Ano8 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Ano8-7739J-F6550 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences AGCCGGGTGACAGGGCCAGA, TCTCGCACAGTCCTTAGCTT, GGGCCTCCACATTTCCACCG and CCAATGGGTCTTGCCTCGAG, which resulted in a 228 bp deletion in exon 3 beginning at Chromosome 8 negative strand position 71,484,949 bp, TGGAAATGTGGAGGCCCTTGT, and ending after CCTGCCTCTACCTCCCTCT at 71,484,722 bp (GRCm38/mm10). This mutation deletes exon 3 and 95 bp of flanking intronic sequence including the splice acceptor and donor. There is an additional 5 bp deletion 95 bp after the 228 bp deletion that will not affect the mutation. This deletion is predicted to cause a change of amino acid sequence after residue 72 and early truncation 14 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Ano8 Mutation:  48 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/18/2025
MGI 6.24
The Jackson Laboratory