Ano8^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ano8^em1(IMPC)J
• Name: anoctamin 8; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5776201
• Synonyms: Ano8^em1J
• Gene: Ano8 Location: Chr8:71928663-71938607 bp, - strand Genetic Position: Chr8, 34.43 cM
• Alliance: Ano8^em1(IMPC)J page
• IMPC: Ano8 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Ano8-7739J-F6550 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences AGCCGGGTGACAGGGCCAGA, TCTCGCACAGTCCTTAGCTT, GGGCCTCCACATTTCCACCG and CCAATGGGTCTTGCCTCGAG, which resulted in a 228 bp deletion in exon 3 beginning at Chromosome 8 negative strand position 71,484,949 bp, TGGAAATGTGGAGGCCCTTGT, and ending after CCTGCCTCTACCTCCCTCT at 71,484,722 bp (GRCm38/mm10). This mutation deletes exon 3 and 95 bp of flanking intronic sequence including the splice acceptor and donor. There is an additional 5 bp deletion 95 bp after the 228 bp deletion that will not affect the mutation. This deletion is predicted to cause a change of amino acid sequence after residue 72 and early truncation 14 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Ano8 Mutation: 48 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)