Ano7em1(IMPC)J
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Ano7em1(IMPC)J |
| Name: |
anoctamin 7; endonuclease-mediated mutation 1, Jackson |
| MGI ID: |
MGI:5775821 |
| Synonyms: |
Ano7em1J |
| Gene: |
Ano7 Location: Chr1:93301652-93332025 bp, + strand Genetic Position: Chr1, 47.24 cM
|
| Alliance: |
Ano7em1(IMPC)J page
|
| IMPC: |
Ano7 gene page |
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele from project Ano7-7738J-M6515 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GTTGGCAGTGAGTCATCTGA, GCTCCTTGTCCCTCTGGCCA, GGTGACAGCAGGAAGCCGGT and AGATCGATCACAAGGAGACC, which resulted in a 181 bp deletion spanning exon 3 beginning at Chromosome 1 positive strand position 93,377,228 bp, GAGTCATCTGATGGTTGGAT, and ending after GGGGTGACAGCAGGAAGCC at 93,377,408 bp (GRCm38/mm10). This mutation deletes exon 3 and 123 bp of flanking intronic sequence including the splice acceptor and donor. There is an additional 15 bp deletion of intronic sequence 38 bp 5-prime of the 181 bp deletion, and an 8 bp deletion of intronic sequence 25 bp after the 181 bp deletion, neither of which is expected to alter the overall outcome of the mutation. This deletion is predicted to cause a change of amino acid sequence after residue 36 and early truncation 9 amino acids later.
(J:188991)
|
| Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
|
|
| Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
| All: |
3 reference(s) |
|