Acod1em1(IMPC)J
Endonuclease-mediated Allele Detail
|
Symbol: |
Acod1em1(IMPC)J |
Name: |
aconitate decarboxylase 1; endonuclease-mediated mutation 1, Jackson |
MGI ID: |
MGI:5775820 |
Synonyms: |
Acod1em1J |
Gene: |
Acod1 Location: Chr14:103284448-103294009 bp, + strand Genetic Position: Chr14, 51.67 cM
|
Alliance: |
Acod1em1(IMPC)J page
|
IMPC: |
Acod1 gene page |
|
Strain of Origin: |
C57BL/6NJ
|
Project Collection: |
IMPC
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutation: |
|
Intragenic deletion
|
|
|
Mutation details: This allele from project Acod1-7676J-M9515 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CAACGATTCTGACAATTTGG, TGAAATTATACCCTAAAAAT, GCAGTGTCGCTTTCCTTGAT and TCGCTTTCCTTGATGGGCAC, which resulted in a 370 bp deletion spanning exon 4 beginning at Chromosome 14 positive strand position 103,051,188 bp, ATTTTTAGGGTATAATTTCA, and ending after TGTGCCCATCAAGGAAAGCG at 103,051,557 bp (GRCm38/mm10). This mutation deletes exon 4 and 164 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 88 and early truncation 49 amino acids later.
(J:188991)
|
Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
All: |
19 reference(s) |
|