Smarcd3em1(IMPC)J
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Smarcd3em1(IMPC)J |
| Name: |
SWI/SNF related BAF chromatin remodeling complex subunit D3; endonuclease-mediated mutation 1, Jackson |
| MGI ID: |
MGI:5775819 |
| Synonyms: |
Smarcd3em1J |
| Gene: |
Smarcd3 Location: Chr5:24797620-24829649 bp, - strand Genetic Position: Chr5, 11.93 cM, cytoband A3
|
| Alliance: |
Smarcd3em1(IMPC)J page
|
| IMPC: |
Smarcd3 gene page |
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele from project Smarcd3-7699J-M8045 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GCACGCCCTTTCACGCGGGG, GCGACCAAGTCATTCTAGCT, CCGCCCCTCTCCAAGACCCT and CCCACTCATCGCTCAGCGCA, which resulted in a 471 bp deletion in exon 2 beginning at Chromosome 5 negative strand position 24,598,924 bp, CAGGGTTACCAACCCAGGGT, and ending after CAGCGACCAAGTCATTCTAG at 24,598,454 bp (GRCm38/mm10). This mutation deletes exon 2 and 259 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 26 and early truncation 7 amino acids later.
(J:188991, J:384794)
|
| Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
|
|
| Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
| All: |
4 reference(s) |
|