About   Help   FAQ
Smarcd3em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Smarcd3em1(IMPC)J
Name: SWI/SNF related BAF chromatin remodeling complex subunit D3; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5775819
Synonyms: Smarcd3em1J
Gene: Smarcd3  Location: Chr5:24797620-24829649 bp, - strand  Genetic Position: Chr5, 11.93 cM, cytoband A3
Alliance: Smarcd3em1(IMPC)J page
IMPC: Smarcd3 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Smarcd3-7699J-M8045 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GCACGCCCTTTCACGCGGGG, GCGACCAAGTCATTCTAGCT, CCGCCCCTCTCCAAGACCCT and CCCACTCATCGCTCAGCGCA, which resulted in a 471 bp deletion in exon 2 beginning at Chromosome 5 negative strand position 24,598,924 bp, CAGGGTTACCAACCCAGGGT, and ending after CAGCGACCAAGTCATTCTAG at 24,598,454 bp (GRCm38/mm10). This mutation deletes exon 2 and 259 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 26 and early truncation 7 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Smarcd3 Mutation:  25 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/25/2025
MGI 6.24
The Jackson Laboratory