About   Help   FAQ
Myo1dem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Myo1dem1(IMPC)J
Name: myosin ID; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5775818
Synonyms: Myo1dem1J
Gene: Myo1d  Location: Chr11:80372952-80670851 bp, - strand  Genetic Position: Chr11, 47.95 cM
Alliance: Myo1dem1(IMPC)J page
IMPC: Myo1d gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences ACATTTGGTAATAAACTAAG, GAAACAGTTACTAGGACATT, TTTTAAATACCTTGCAGCTT and GCTGTGATTCCAAAGCTGCA into zygotes, which resulted in a 334 bp deletion at Chr 11: 80,692,846-80,693,179 bp (GRCm38/mm10). This deletion includes ENSMUSE00001265867. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Myo1d Mutation:  58 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/25/2025
MGI 6.24
The Jackson Laboratory