Sh3d19em1(IMPC)J
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Sh3d19em1(IMPC)J |
| Name: |
SH3 domain protein D19; endonuclease-mediated mutation 1, Jackson |
| MGI ID: |
MGI:5775777 |
| Synonyms: |
Sh3d19em1J |
| Gene: |
Sh3d19 Location: Chr3:85878416-86037833 bp, + strand Genetic Position: Chr3, 37.83 cM, cytoband F1
|
| Alliance: |
Sh3d19em1(IMPC)J page
|
| IMPC: |
Sh3d19 gene page |
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele from project Sh3d19-7698J-M1095 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences AATCCTGGACTAGCCATTGC, CCTGAATGTTTGGGCTCCCT, TCTTAGGCCTAACCACCGCT and AGCAACTGAACACTCGGAAC, which resulted in a 208 bp deletion spanning exon 3 beginning at Chromosome 3 positive strand position 86,098,069 bp, GGAGCCCAAACATTCAGGTC, and ending after CCAGTAAGTGATACCGAGCG at 86,098,276 bp (GRCm38/mm10). This mutation deletes exon 3 and 95 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a stop after residue 266.
(J:188991, J:384794)
|
| Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
| Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
| All: |
4 reference(s) |
|