Sh3d19^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Sh3d19^em1(IMPC)J
• Name: SH3 domain protein D19; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5775777
• Synonyms: Sh3d19^em1J
• Gene: Sh3d19 Location: Chr3:85878416-86037833 bp, + strand Genetic Position: Chr3, 37.83 cM, cytoband F1
• Alliance: Sh3d19^em1(IMPC)J page
• IMPC: Sh3d19 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Sh3d19-7698J-M1095 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences AATCCTGGACTAGCCATTGC, CCTGAATGTTTGGGCTCCCT, TCTTAGGCCTAACCACCGCT and AGCAACTGAACACTCGGAAC, which resulted in a 208 bp deletion spanning exon 3 beginning at Chromosome 3 positive strand position 86,098,069 bp, GGAGCCCAAACATTCAGGTC, and ending after CCAGTAAGTGATACCGAGCG at 86,098,276 bp (GRCm38/mm10). This mutation deletes exon 3 and 95 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a stop after residue 266. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Sh3d19 Mutation: 43 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)