About   Help   FAQ
Wdfy4em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Wdfy4em1(IMPC)J
Name: WD repeat and FYVE domain containing 4; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5775775
Synonyms: Wdfy4em1J
Gene: Wdfy4  Location: Chr14:32681504-32907465 bp, - strand  Genetic Position: Chr14, 19.44 cM
Alliance: Wdfy4em1(IMPC)J page
IMPC: Wdfy4 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Wdyf4-7724J-M9881 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences AGTCTATGAGGAAAGGGGAC, CAGGCCTCGAAGGTGTTCCC, CATGTAGCCTTGAGGTACAT and GTTTTGGGAGCTGCGTGGAT, which resulted in a 249 bp deletion spanning exon 4 beginning at Chromosome 14 negative strand position 33,154,162 bp, CTGCGTGGATAGGATGCATC, and ending after CCTGTCCCCTTTCCTCATAG at 33,153,914 bp (GRCm38/mm10). This mutation deletes exon 4 and 142 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 116 and early truncation 30 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Wdfy4 Mutation:  142 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  7 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
09/30/2025
MGI 6.24
The Jackson Laboratory