About   Help   FAQ
Paf1em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Paf1em1(IMPC)J
Name: Paf1, RNA polymerase II complex component; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5775649
Synonyms: Paf1em1J
Gene: Paf1  Location: Chr7:28092376-28098813 bp, + strand  Genetic Position: Chr7, 16.73 cM
Alliance: Paf1em1(IMPC)J page
IMPC: Paf1 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutations:    Insertion, Intragenic deletion
 
Mutation detailsThis allele from project Paf1-7694J-M6789 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TGAATGCAAGCGTCCAGCAT, TCCTAGAAGCTAAGCTTCTA, GGCCAGCAAAGGCCAGGCCT and CCATGAGGGATACCCAGGCC, which resulted in a 290 bp deletion and 6 bp insertion (ttgcaa) spanning exon 4 beginning at Chromosome 7 positive strand position 28,395,305 bp, CTGGACGCTTGCATTCAGAG, and ending after AGCAAAGGCCAGGCCTGGGT at 28,395,594 bp (GRCm38/mm10). This mutation deletes exon 4 and 168 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 56 and early truncation 6 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Paf1 Mutation:  21 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/18/2025
MGI 6.24
The Jackson Laboratory