Tcerg1^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Tcerg1^em1(IMPC)J
• Name: transcription elongation regulator 1 (CA150); endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5775646
• Synonyms: Tcerg1^em1J
• Gene: Tcerg1 Location: Chr18:42644552-42708858 bp, + strand Genetic Position: Chr18, 22.66 cM
• Alliance: Tcerg1^em1(IMPC)J page
• IMPC: Tcerg1 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutations: Insertion, Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory using Cas9 and guides with spacer sequences GCAGCTCCAAGGTCACATGG, TATTTTCCCAAGCCTAGAGA, TTAGTATCAATTTTATGCAT, and TTATAGAGGTTGCCATTTCT that targeted exon(s) ENSMUSE00000246318.2. This resulted in deletion(s) of 2 bp (location: Chr18:42652328-42652329; GRCm39), 343 bp (location: Chr18:42652370-42652712; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

• Inheritance: Not Specified

Expression

In Mice Carrying this Mutation:

1 RNA-Seq or microarray experiment(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Tcerg1 Mutation: 71 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 5 reference(s)