Tcerg1em1(IMPC)J
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Tcerg1em1(IMPC)J |
| Name: |
transcription elongation regulator 1 (CA150); endonuclease-mediated mutation 1, Jackson |
| MGI ID: |
MGI:5775646 |
| Synonyms: |
Tcerg1em1J |
| Gene: |
Tcerg1 Location: Chr18:42644552-42708858 bp, + strand Genetic Position: Chr18, 22.66 cM
|
| Alliance: |
Tcerg1em1(IMPC)J page
|
| IMPC: |
Tcerg1 gene page |
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutations: |
|
Insertion, Intragenic deletion
|
| |
|
Mutation details: This allele from project Tcerg1-7710J-M6904 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GCAGCTCCAAGGTCACATGG, TATTTTCCCAAGCCTAGAGA, TTAGTATCAATTTTATGCAT and TTATAGAGGTTGCCATTTCT, which resulted in a 343 bp deletion spanning exon 2 beginning at Chromosome 18 positive strand position 42,519,305 bp, CCATGTGACCTTGGAGCTGC, and ending after GTGTTAGTATCAATTTTATG at 42,519,647 bp (GRCm38/mm10). This mutation deletes exon 2 and 117 bp of flanking intronic sequence including the splice acceptor and donor. There is an additional 2 bp deletion 40 bp before the 343 bp deletion and a 6 bp insertion (gtatta) at the 343 bp deletion site, that will not affect the results of the mutation. This deletion is predicted to cause a change of amino acid sequence after residue 20 and early truncation 17 amino acids later.
(J:188991, J:384794)
|
| Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
|
|
| Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
| All: |
5 reference(s) |
|