About   Help   FAQ
Trav1em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Trav1em1(IMPC)J
Name: T cell receptor alpha variable 1; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5775635
Synonyms: Trav1em1J
Gene: Trav1  Location: Chr14:52665424-52666333 bp, + strand  Genetic Position: Chr14, 26.94 cM
Alliance: Trav1em1(IMPC)J page
IMPC: Trav1 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Trav1-7381J-M0733 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences AATTTTTAAACAATTCAACG, ATTTTTAAACAATTCAACGT, GCTGCACAGAAATTCTAAGA and AGCTGCACAGAAATTCTAAG, which resulted in a 434 bp deletion spanning exon 2 beginning at Chromosome 14 positive strand position 52,428,493 bp, ATTTTTTAAAATTAATTTTT, and ending after ACAGAAATTCTAAGAGGGAC at 52,428,926 bp (GRCm38/mm10). This mutation deletes exon 2 and 151 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 16 and early truncation 10 amino acids later, by run on into intron 2. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Trav1 Mutation:  4 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/24/2026
MGI 6.24
The Jackson Laboratory