Zscan12^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Zscan12^em1(IMPC)J
• Name: zinc finger and SCAN domain containing 12; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5775626
• Synonyms: Zscan12^em1J
• Gene: Zscan12 Location: Chr13:21546990-21556459 bp, + strand Genetic Position: Chr13, 7.76 cM, cytoband A3.1
• Alliance: Zscan12^em1(IMPC)J page
• IMPC: Zscan12 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Zscan12-7729J-M3081 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CCTGCCTGCTCAAGCCCGGA, TCGATCGCACTCATTTTTCA, GTTTCTCGTTAAAAGTGAGA and AACAGGCTGATAGGACCCCA, which resulted in a 298 bp deletion spanning exon 3 beginning at Chromosome 13 positive strand position 21,366,532 bp, GGGCTTGAGCAGGCAGGAGC, and ending after GCTGTTTCTCGTTAAAAGTG at 21,366,829 bp (GRCm38/mm10). This mutation deletes exon 3 and 156 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 134 and early truncation 14 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Zscan12 Mutation: 26 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)