About   Help   FAQ
Ssh1em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Ssh1em1(IMPC)J
Name: slingshot protein phosphatase 1; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5775609
Synonyms: Ssh1em1J
Gene: Ssh1  Location: Chr5:114075155-114131864 bp, - strand  Genetic Position: Chr5, 55.82 cM
Alliance: Ssh1em1(IMPC)J page
IMPC: Ssh1 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Ssh1-7708J-M9161 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences ACTGTTGTACGGTTGAAAAA, TCACCTACTTCCCGGACCTA, GATAAAGGCATCCAGGAAGG and CAGGGGGTGTGTCTCGAACA, which resulted in a 189 bp deletion spanning exon 2 beginning at Chromosome 5 negative strand position 113,989,807 bp, GTCTCGAACACGGCAGCCTC, and ending after CACTTGGCGTTTGTCCTTAG at 113,989,619 bp (GRCm38/mm10). This mutation deletes exon 2 and 148 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to result in early termination after amino acid residue 21. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Ssh1 Mutation:  35 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/29/2025
MGI 6.24
The Jackson Laboratory