Ssh1^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ssh1^em1(IMPC)J
• Name: slingshot protein phosphatase 1; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5775609
• Synonyms: Ssh1^em1J
• Gene: Ssh1 Location: Chr5:114075155-114131864 bp, - strand Genetic Position: Chr5, 55.82 cM
• Alliance: Ssh1^em1(IMPC)J page
• IMPC: Ssh1 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Ssh1-7708J-M9161 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences ACTGTTGTACGGTTGAAAAA, TCACCTACTTCCCGGACCTA, GATAAAGGCATCCAGGAAGG and CAGGGGGTGTGTCTCGAACA, which resulted in a 189 bp deletion spanning exon 2 beginning at Chromosome 5 negative strand position 113,989,807 bp, GTCTCGAACACGGCAGCCTC, and ending after CACTTGGCGTTTGTCCTTAG at 113,989,619 bp (GRCm38/mm10). This mutation deletes exon 2 and 148 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to result in early termination after amino acid residue 21. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Ssh1 Mutation: 35 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)