About   Help   FAQ
Zfp560em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Zfp560em1(IMPC)J
Name: zinc finger protein 560; endonuclease-mediated mutation Jackson
MGI ID: MGI:5774464
Synonyms: Zfp560em1J
Gene: Zfp560  Location: Chr9:20256432-20296473 bp, - strand  Genetic Position: Chr9, 7.52 cM
Alliance: Zfp560em1(IMPC)J page
IMPC: Zfp560 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Zfp560-7726J-F3047 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences ATGGAACCATGTCAGCCGAA, TTACATCCATTCGGCTGACA, ATTCCCATATAGTCCAACAT and CATGGATGTCACTCTATCCT, which resulted in a 229 bp deletion spanning exon 3 beginning at Chromosome 9 negative strand position 20,352,939 bp, TATGTTGGACTATATGGGAA, and ending after TGTTACATCCATTCGGCTGA at 20,352,711 bp (GRCm38/mm10). This mutation deletes exon 3 and 140 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 9 and early truncation 4 amino acids later. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Zfp560 Mutation:  30 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory