Prss36^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Prss36^em1(IMPC)J
• Name: serine protease 36; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5774444
• Synonyms: Prss36^em1J
• Gene: Prss36 Location: Chr7:127531810-127545897 bp, - strand Genetic Position: Chr7, 69.84 cM
• Alliance: Prss36^em1(IMPC)J page
• IMPC: Prss36 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Prss36-7695J-F6710 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GGTATTCAGCCTGGACAGCG, GAAGGTTGAGCTGCTGCGCA, ACCGAGCTTTGACTTCTAGG and GAGACCCTGGTAACTCGGGG, which resulted in a 352 bp deletion spanning exon 4 beginning at Chromosome 7 negative strand position 127,945,488 bp, CCGAGTTACCAGGGTCTCTG, and ending after CTGGCAATGCCACGCTGTCC at 127,945,137 bp (GRCm38/mm10). This mutation deletes exon 4 and 189 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 37 and early truncation 35 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Prss36 Mutation: 60 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)