Prss36em1(IMPC)J
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Prss36em1(IMPC)J |
| Name: |
serine protease 36; endonuclease-mediated mutation 1, Jackson |
| MGI ID: |
MGI:5774444 |
| Synonyms: |
Prss36em1J |
| Gene: |
Prss36 Location: Chr7:127531810-127545897 bp, - strand Genetic Position: Chr7, 69.84 cM
|
| Alliance: |
Prss36em1(IMPC)J page
|
| IMPC: |
Prss36 gene page |
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele from project Prss36-7695J-F6710 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GGTATTCAGCCTGGACAGCG, GAAGGTTGAGCTGCTGCGCA, ACCGAGCTTTGACTTCTAGG and GAGACCCTGGTAACTCGGGG, which resulted in a 352 bp deletion spanning exon 4 beginning at Chromosome 7 negative strand position 127,945,488 bp, CCGAGTTACCAGGGTCTCTG, and ending after CTGGCAATGCCACGCTGTCC at 127,945,137 bp (GRCm38/mm10). This mutation deletes exon 4 and 189 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 37 and early truncation 35 amino acids later.
(J:188991)
|
| Inheritance: |
|
Not Specified |
|
|
|
|
| Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
| All: |
2 reference(s) |
|