Klhl2^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Klhl2^em1(IMPC)J
• Name: kelch-like 2, Mayven; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5771568
• Synonyms: Klhl2^em1J
• Gene: Klhl2 Location: Chr8:65192709-65302669 bp, - strand Genetic Position: Chr8, 32.3 cM
• Alliance: Klhl2^em1(IMPC)J page
• IMPC: Klhl2 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Klhl2-7678J-M9574 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GCTGACAACAAAAGTTACCA, GTCTGAATACACCTTCGAAG, TTTGCATAGAACGTTGAGTA and ACGTTGAGTATGGTTATTAT, which resulted in a 205 bp deletion spanning exon 3 beginning at Chromosome 8 negative strand position 64,823,140 bp, TTATTGGAGGCATTTACATT, and ending after CCTGAGACCCTTCCGTGGTA at 64,822,936 bp (GRCm38/mm10). This mutation deletes exon 3 and 98 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 50 and early truncation 1 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Klhl2 Mutation: 31 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)