About   Help   FAQ
Klhl2em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Klhl2em1(IMPC)J
Name: kelch-like 2, Mayven; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5771568
Synonyms: Klhl2em1J
Gene: Klhl2  Location: Chr8:65192709-65302669 bp, - strand  Genetic Position: Chr8, 32.3 cM
Alliance: Klhl2em1(IMPC)J page
IMPC: Klhl2 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Klhl2-7678J-M9574 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GCTGACAACAAAAGTTACCA, GTCTGAATACACCTTCGAAG, TTTGCATAGAACGTTGAGTA and ACGTTGAGTATGGTTATTAT, which resulted in a 205 bp deletion spanning exon 3 beginning at Chromosome 8 negative strand position 64,823,140 bp, TTATTGGAGGCATTTACATT, and ending after CCTGAGACCCTTCCGTGGTA at 64,822,936 bp (GRCm38/mm10). This mutation deletes exon 3 and 98 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 50 and early truncation 1 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Klhl2 Mutation:  31 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/30/2025
MGI 6.24
The Jackson Laboratory