Tg(Rnu7-SMN2*,PGK1-EGFP)4Dasch
Transgene Detail
|
|
| Symbol: |
Tg(Rnu7-SMN2*,PGK1-EGFP)4Dasch |
| Name: |
transgene insertion 4, Daniel Schuemperli |
| MGI ID: |
MGI:5767008 |
| Synonyms: |
U7-ESE-B |
| Transgene: |
Tg(Rnu7-SMN2*,PGK1-EGFP)4Dasch Location: unknown
|
| Alliance: |
Tg(Rnu7-SMN2*,PGK1-EGFP)4Dasch page
|
|
| Strain of Origin: |
C57BL/6J x DBA/2J
|
|
| Transgene Type: |
|
Transgenic (Knockdown, Reporter) |
| Mutation: |
|
Insertion
|
| |
|
Mutation details: The U7-ESE-B splicing correction cassette encodes a tailed antisense oligonucleotide directed to the 3' part of human SMN2 exon 7 and an additional splicing enhancer sequence. To create this cassette, a 570 bp region of the U7 wild-type gene (Rnu7) was obtained containing 341 bp 5' flanking sequence (including the distal and proximal sequence promoter elements [DSE and PSE]), 62 bp U7 snRNA coding region and 167 bp 3' sequence (including the 3' box). The 5'GGA non-complementary "tail" sequence (GGAGGACGGAGGACGGAGGAC), predicted to mimic the exonic splicing enhancer (ESE) sequence of an SF2/ASF/SRSF1 binding site, was introduced. The antisense sequence complementary to the histone downstream element in replication-dependent histone pre-mRNAs was changed to a sequence binding to positions 33-50 in the 3' region (position B [also called B1]) of the weak exon 7 of human SMN2. The Sm binding site (aatttGtCT) was changed to the Sm OPT sequence (aatttTtGG ; corresponding to the consensus sequence found in spliceosomal snRNAs). As a consequence, the resulting snRNA no longer binds the U7-specific Sm-like proteins Lsm10 and Lsm11 but rather the five standard Sm proteins found in spliceosomal snRNPs. These changes in snRNP assembly render the RNA non-functional for histone RNA processing and additionally allow it to accumulate in cell nuclei about 3 times more efficiently. The resulting U7-ESE-B splicing correction cassette was introduced into the third generation (self-inactivating) lentiviral vector pRRL-SIN-cPPT-hPGK-GFP-WPRE. The resulting approximate 4.4 kbp transgene had the U7-ESE-B inserted upstream of the hPGK promoter and in sense orientation with EGFP. Line 4 has 8 copies of the transgene.
(J:231141)
|
|
|
| Mouse strains and cell lines
available from the International Mouse Strain Resource
(IMSR) |
| Carrying this Mutation: |
Mouse Strains: 1 strain available
Cell Lines: 0 lines available
|
|
| Original: |
J:231141 Voigt T, et al., Ultrastructural changes in diaphragm neuromuscular junctions in a severe mouse model for Spinal Muscular Atrophy and their prevention by bifunctional U7 snRNA correcting SMN2 splicing. Neuromuscul Disord. 2010 Nov;20(11):744-52 |
| All: |
5 reference(s) |
|