Lamp5em1(IMPC)J
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Lamp5em1(IMPC)J |
| Name: |
lysosomal-associated membrane protein family, member 5; endonuclease-mediated mutation 1, Jackson |
| MGI ID: |
MGI:5766991 |
| Synonyms: |
Lamp5em1J |
| Gene: |
Lamp5 Location: Chr2:135894159-135911837 bp, + strand Genetic Position: Chr2, 67.26 cM, cytoband G1
|
| Alliance: |
Lamp5em1(IMPC)J page
|
| IMPC: |
Lamp5 gene page |
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele from project Lamp5-7679J-M9591 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CTCAGGTGTCCTAAAGCAGA, GGAGCACACTGCTTCGAGCA, CTAGGGGCGGCAGGGCCGAA and ATTCGGGAACAGCCTGCGGG, which resulted in a 405 bp deletion spanning exon 2 beginning at Chromosome 2 positive strand position 136,058,830 bp, CTGCTTCGAGCAGGGAACTT, and ending after CTTCCCCCCCAAACCCCCCG at 136,059,234 bp (GRCm38/mm10). This mutation deletes exon 2 and 232 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 21 and early truncation 6 amino acids later.
(J:188991)
|
| Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
|
|
| Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
| All: |
3 reference(s) |
|