About   Help   FAQ
Lamp5em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Lamp5em1(IMPC)J
Name: lysosomal-associated membrane protein family, member 5; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5766991
Synonyms: Lamp5em1J
Gene: Lamp5  Location: Chr2:135894159-135911837 bp, + strand  Genetic Position: Chr2, 67.26 cM, cytoband G1
Alliance: Lamp5em1(IMPC)J page
IMPC: Lamp5 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Lamp5-7679J-M9591 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CTCAGGTGTCCTAAAGCAGA, GGAGCACACTGCTTCGAGCA, CTAGGGGCGGCAGGGCCGAA and ATTCGGGAACAGCCTGCGGG, which resulted in a 405 bp deletion spanning exon 2 beginning at Chromosome 2 positive strand position 136,058,830 bp, CTGCTTCGAGCAGGGAACTT, and ending after CTTCCCCCCCAAACCCCCCG at 136,059,234 bp (GRCm38/mm10). This mutation deletes exon 2 and 232 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 21 and early truncation 6 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Lamp5 Mutation:  30 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
04/07/2026
MGI 6.24
The Jackson Laboratory