About   Help   FAQ
Clstn2em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Clstn2em1(IMPC)J
Name: calsyntenin 2; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5766210
Synonyms: Clstn2em1J
Gene: Clstn2  Location: Chr9:97326448-97915234 bp, - strand  Genetic Position: Chr9, 51.06 cM, cytoband E4
Alliance: Clstn2em1(IMPC)J page
IMPC: Clstn2 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Clstn2-7604J-M4612 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CCAACGGTGTGCTTGGAAGG, CCTGTCGCCCACCTTCTCCC, TTGTAGATCCAGCTCTGTCG and TCACCATGCTCAACTAGACT, which resulted in a 445 bp deletion spanning exon 3 beginning at Chromosome 9 negative strand position 97,583,831 bp, GTCTAGTTGAGCATGGTGAAT, and ending after CACCAACGGTGTGCTTGGAA at 97,583,387 bp (GRCm38/mm10). This mutation deletes exon 3 and 249 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 80 and early truncation 6 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Clstn2 Mutation:  56 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  4 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/06/2026
MGI 6.24
The Jackson Laboratory