About   Help   FAQ
Fam110dem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Fam110dem1(IMPC)J
Name: family with sequence similarity 110, member D; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5763786
Synonyms: Grrp1em1J
Gene: Fam110d  Location: Chr4:133978421-133981417 bp, - strand  Genetic Position: Chr4, 66.5 cM
Alliance: Fam110dem1(IMPC)J page
IMPC: Fam110d gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Grrp1-7625J-M2529 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GTTCCACCACCGACACCGTG, GCGGCGACGTTGCGACCTGA, TCACCCACTACACCTTCGAG and TATCTTTTACCGCCAGAAGA, which resulted in a 698 bp deletion in exon 2 beginning at Chromosome 4 negative strand position 134,252,135 bp, AGGGGACGAACCCCCAGCGCC, and ending after GCGGGACGGACGCCCCACGGT at 134,251,438 bp (GRCm38/mm10). This mutation is predicted to cause a change of amino acid sequence after residue 10 and early truncation 26 amino acids later. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Fam110d Mutation:  9 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/24/2026
MGI 6.24
The Jackson Laboratory