Fibinem1(IMPC)J
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Fibinem1(IMPC)J |
| Name: |
fin bud initiation factor homolog (zebrafish); endonuclease-mediated mutation 1, Jackson |
| MGI ID: |
MGI:5763773 |
| Synonyms: |
Fibinem1J |
| Gene: |
Fibin Location: Chr2:110191270-110193338 bp, - strand Genetic Position: Chr2, 56.7 cM, cytoband E3
|
| Alliance: |
Fibinem1(IMPC)J page
|
| IMPC: |
Fibin gene page |
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele from project Fibin-7609J-M4502 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CTGAAAAGCGACTATCTGGA, GTAGGCATCCCCGATCTGGT, GCTGAGCCTCACTCTTCGAG and TCGCAGGCGCTGCTCCCAGG, which resulted in a 445 bp deletion in exon 1 beginning at Chromosome 2 negative strand position 110,362,610 bp, GCGCTGCTCCCAGGGGGAAGG, and ending after CTGAAAAGCGACTATCTGGAG at 110,362,166 bp (GRCm38/mm10). This mutation is predicted to cause a change of amino acid sequence after residue 62 and stop 39 amino acids later, due to read through into the 3UTR.
(J:188991, J:384794)
|
| Inheritance: |
|
Not Specified |
|
|
|
|
| Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
| All: |
3 reference(s) |
|