Fibinem1(IMPC)J
Endonuclease-mediated Allele Detail
|
Symbol: |
Fibinem1(IMPC)J |
Name: |
fin bud initiation factor homolog (zebrafish); endonuclease-mediated mutation 1, Jackson |
MGI ID: |
MGI:5763773 |
Synonyms: |
Fibinem1J |
Gene: |
Fibin Location: Chr2:110191270-110193338 bp, - strand Genetic Position: Chr2, 56.7 cM, cytoband E3
|
Alliance: |
Fibinem1(IMPC)J page
|
IMPC: |
Fibin gene page |
|
Strain of Origin: |
C57BL/6NJ
|
Project Collection: |
IMPC
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutation: |
|
Intragenic deletion
|
|
|
Mutation details: This allele from project Fibin-7609J-M4502 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CTGAAAAGCGACTATCTGGA, GTAGGCATCCCCGATCTGGT, GCTGAGCCTCACTCTTCGAG and TCGCAGGCGCTGCTCCCAGG, which resulted in a 445 bp deletion in exon 1 beginning at Chromosome 2 negative strand position 110,362,610 bp, GCGCTGCTCCCAGGGGGAAGG, and ending after CTGAAAAGCGACTATCTGGAG at 110,362,166 bp (GRCm38/mm10). This mutation is predicted to cause a change of amino acid sequence after residue 62 and stop 39 amino acids later, due to read through into the 3UTR.
(J:188991)
|
Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
All: |
3 reference(s) |
|