About   Help   FAQ
Fibinem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Fibinem1(IMPC)J
Name: fin bud initiation factor homolog (zebrafish); endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5763773
Synonyms: Fibinem1J
Gene: Fibin  Location: Chr2:110191270-110193338 bp, - strand  Genetic Position: Chr2, 56.7 cM, cytoband E3
Alliance: Fibinem1(IMPC)J page
IMPC: Fibin gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Fibin-7609J-M4502 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CTGAAAAGCGACTATCTGGA, GTAGGCATCCCCGATCTGGT, GCTGAGCCTCACTCTTCGAG and TCGCAGGCGCTGCTCCCAGG, which resulted in a 445 bp deletion in exon 1 beginning at Chromosome 2 negative strand position 110,362,610 bp, GCGCTGCTCCCAGGGGGAAGG, and ending after CTGAAAAGCGACTATCTGGAG at 110,362,166 bp (GRCm38/mm10). This mutation is predicted to cause a change of amino acid sequence after residue 62 and stop 39 amino acids later, due to read through into the 3UTR. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Fibin Mutation:  16 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory