Col16a1^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Col16a1^em1(IMPC)J
• Name: collagen, type XVI, alpha 1; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5763667
• Synonyms: Col16a1^em1J
• Gene: Col16a1 Location: Chr4:129941638-129993070 bp, + strand Genetic Position: Chr4, 63.43 cM
• Alliance: Col16a1^em1(IMPC)J page
• IMPC: Col16a1 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Col16a1-7606J-F4542 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GGAGCATTAGGAACTCAGGA, AGAATTCCCGGAGCTCTGCT, AGGTCACTATGAACTCTGGG and TCTACCTATTGTCCACCACT, which resulted in a 437 bp deletion spanning exons 3 and 4 beginning at Chromosome 4 positive strand position 130051616 bp, CTCCTGAGTTCCTAATGCTC, and ending after ACTCTACCTATTGTCCACCA, at 130052052 bp (GRCm38/mm10). This mutation deletes exons 3 and 4 and 244 bp of flanking intronic and intron 3-4 sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 24 and early truncation 15 amino acids later. In addition, there is a 5 bp (ctctg) deletion 13 bp before the 437 bp deletion that is not predicted to impact the outcome of this mutation. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Col16a1 Mutation: 59 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)