Wscd2em1(IMPC)J
Endonuclease-mediated Allele Detail
|
Symbol: |
Wscd2em1(IMPC)J |
Name: |
WSC domain containing 2; endonuclease-mediated mutation 1, Jackson |
MGI ID: |
MGI:5763626 |
Synonyms: |
Wscd2em1J |
Gene: |
Wscd2 Location: Chr5:113638199-113727786 bp, + strand Genetic Position: Chr5, 55.55 cM
|
Alliance: |
Wscd2em1(IMPC)J page
|
IMPC: |
Wscd2 gene page |
|
Strain of Origin: |
C57BL/6NJ
|
Project Collection: |
IMPC
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutation: |
|
Intragenic deletion
|
|
|
Mutation details: This allele from project Wscd2-7568J-M3187 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences ATATGGGCAGTAGGAACTAG, GTTTCCATCTCTTGAATATC, GGACATGTCTGGGGATATGG and GTTCGCCTTGGCTTGTCAGA, which resulted in a 388 bp deletion spanning exon 3 (ENSMUSE00000478656) beginning at Chromosome 5 positive strand position 113,558,183 bp, AGTTCCTACTGCCCATATTGG and ending after TTCGCCTTGGCTTGTCAGAG at 113,558,570 bp (GRCm38/mm10) with 3 base pairs (AAT) left in place of this deletion. This mutation deletes exon 3 and 270 bp of flanking intronic sequence, including the splice acceptor and donor, and is predicted to result in a change in amino acid sequence after residue 133 and a early truncation an additional 24 amino acids later.
(J:188991)
|
Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
All: |
2 reference(s) |
|