About   Help   FAQ
St6galnac3em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: St6galnac3em1(IMPC)J
Name: ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 3; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5763623
Synonyms: St6galnac3em1J
Gene: St6galnac3  Location: Chr3:152903911-153430804 bp, - strand  Genetic Position: Chr3, 77.82 cM, cytoband H4
Alliance: St6galnac3em1(IMPC)J page
IMPC: St6galnac3 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project St6galnac3-7558J-M9635 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TACGTCATGAGCCAACACAG, GTTCACTTGACAGCCGGCAG, TTGATTCCTCAAGCACTCAT and GCTACAGGTGTAGCCTTTAT, which resulted in a 708 bp deletion spanning exon 3 beginning at Chromosome 3 negative strand position 153,412,014 bp, GTCCAATAAAGGCTACACCT, and ending after CGTCATGAGCCAACACAGAG at 153,411,307 bp (GRCm38/mm10). This mutation deletes exon 3 and 298 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 71 and early truncation 31 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 2 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any St6galnac3 Mutation:  34 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/06/2026
MGI 6.24
The Jackson Laboratory