Oaz2em1(IMPC)J
Endonuclease-mediated Allele Detail
|
Symbol: |
Oaz2em1(IMPC)J |
Name: |
ornithine decarboxylase antizyme 2; endonuclease-mediated mutation 1, Jackson |
MGI ID: |
MGI:5763465 |
Synonyms: |
Oaz2em1J |
Gene: |
Oaz2 Location: Chr9:65583830-65597582 bp, + strand Genetic Position: Chr9, 35.45 cM
|
Alliance: |
Oaz2em1(IMPC)J page
|
IMPC: |
Oaz2 gene page |
|
Strain of Origin: |
C57BL/6NJ
|
Project Collection: |
IMPC
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutation: |
|
Intragenic deletion
|
|
|
Mutation details: This allele from project Oaz2-7565J-M3140 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CTGCCCTGAGAATGGCCCAA, TCCTATGCTCCCTAAACCAA, TGGGAATCTGATAAACTGGT and CAAAACATCTACTAACTCAG, which resulted in a 463 bp deletion spanning exon 4 beginning at Chromosome 9 positive strand position 65,687,700 bp, CTGAGAATGGCCCAAGGGAT, and ending after CCACCAGTTTATCAGATTCC at 65688162 bp (GRCm38/mm10). This mutation deletes exon 4 and 287 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 59 and early truncation 8 amino acids later.
(J:188991)
|
Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
All: |
2 reference(s) |
|