Patjem1(IMPC)J
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Patjem1(IMPC)J |
| Name: |
PATJ, crumbs cell polarity complex component; endonuclease-mediated mutation 1, Jackson |
| MGI ID: |
MGI:5763464 |
| Synonyms: |
Patjem1J |
| Gene: |
Patj Location: Chr4:98284022-98607840 bp, + strand Genetic Position: Chr4, 45.6 cM
|
| Alliance: |
Patjem1(IMPC)J page
|
| IMPC: |
Patj gene page |
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele from project Inadl-7544J-M2535 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GGACCTGCGTGCGTGTTAGC, AACTGACGCTGCTCAGCACA, CACCTGCTGCTGATTTTGAA and AGTAACACTAGCCTTGGTGC, which resulted in a 395 bp deletion spanning exon 5 beginning at Chromosome 4 positive strand position 98,410,884 bp, GTTAGCCGGCTGCTGAGCATG, and ending after GTAACACTAGCCTTGGTGCTG at 98,411,278 bp (GRCm38/mm10). This mutation deletes exon 5 and 255 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to result in a change in amino acid sequence after residue 129 and early truncation 6 amino acids later.
(J:188991, J:384794)
|
| Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
|
|
| Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
| All: |
4 reference(s) |
|