About   Help   FAQ
Patjem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Patjem1(IMPC)J
Name: PATJ, crumbs cell polarity complex component; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5763464
Synonyms: Patjem1J
Gene: Patj  Location: Chr4:98284022-98607840 bp, + strand  Genetic Position: Chr4, 45.6 cM
Alliance: Patjem1(IMPC)J page
IMPC: Patj gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Inadl-7544J-M2535 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GGACCTGCGTGCGTGTTAGC, AACTGACGCTGCTCAGCACA, CACCTGCTGCTGATTTTGAA and AGTAACACTAGCCTTGGTGC, which resulted in a 395 bp deletion spanning exon 5 beginning at Chromosome 4 positive strand position 98,410,884 bp, GTTAGCCGGCTGCTGAGCATG, and ending after GTAACACTAGCCTTGGTGCTG at 98,411,278 bp (GRCm38/mm10). This mutation deletes exon 5 and 255 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to result in a change in amino acid sequence after residue 129 and early truncation 6 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Patj Mutation:  97 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory