Patj^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Patj^em1(IMPC)J
• Name: PATJ, crumbs cell polarity complex component; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5763464
• Synonyms: Patj^em1J
• Gene: Patj Location: Chr4:98284022-98607840 bp, + strand Genetic Position: Chr4, 45.6 cM
• Alliance: Patj^em1(IMPC)J page
• IMPC: Patj gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Inadl-7544J-M2535 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GGACCTGCGTGCGTGTTAGC, AACTGACGCTGCTCAGCACA, CACCTGCTGCTGATTTTGAA and AGTAACACTAGCCTTGGTGC, which resulted in a 395 bp deletion spanning exon 5 beginning at Chromosome 4 positive strand position 98,410,884 bp, GTTAGCCGGCTGCTGAGCATG, and ending after GTAACACTAGCCTTGGTGCTG at 98,411,278 bp (GRCm38/mm10). This mutation deletes exon 5 and 255 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to result in a change in amino acid sequence after residue 129 and early truncation 6 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Patj Mutation: 96 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)