Cnksr2em1(IMPC)J
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Cnksr2em1(IMPC)J |
| Name: |
connector enhancer of kinase suppressor of Ras 2; endonuclease-mediated mutation 1, Jackson |
| MGI ID: |
MGI:5763463 |
| Synonyms: |
Cnksr2em1J |
| Gene: |
Cnksr2 Location: ChrX:156604432-156826290 bp, - strand Genetic Position: ChrX, 72.76 cM
|
| Alliance: |
Cnksr2em1(IMPC)J page
|
| IMPC: |
Cnksr2 gene page |
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele from project Cnksr2-7605J-M4582 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences ATAAGTAACCCCACATACAT, TGTACAAACCGATGTATGTG, TTGTCCCACTGCCATCACAT and GAAAAGCTTTTAATAAATAA, which resulted in a 321 bp deletion spanning exon 3 beginning at Chromosome X negative strand position 157994008 bp, CATAGGATGATGAAAAGCTT, and ending after TAAGTAACCCCACATACATCG at 157993688 bp (GRCm38/mm10). This mutation deletes exon 3 and 118 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to result in a change in amino acid sequence after residue 76 and early truncation 14 amino acids later.
(J:188991, J:384794)
|
| Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
|
|
| Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
| All: |
4 reference(s) |
|