Cuedc1^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Cuedc1^em1(IMPC)J
• Name: CUE domain containing 1; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5763461
• Synonyms: Cuedc1^em1J
• Gene: Cuedc1 Location: Chr11:87989972-88084966 bp, + strand Genetic Position: Chr11, 52.4 cM
• Alliance: Cuedc1^em1(IMPC)J page
• IMPC: Cuedc1 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Cuedc1-7438J-M5795 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences AAACTCCTAGGACACGTCCT, ACCTAAGGCCAGCATCGCCA, ATTTTTGTCTCAGAGCGCAG and GTGGCAAGAGACATTTTCAC, which resulted in a 435 bp deletion spanning ENSMUSE00001255541 (exon 3) beginning at Chromosome 11 positive strand position 88,177,110 bp, GCCAAGGAGTAGCTCCTAGC, and ending after TGTGGCAAGAGACATTTTCAC at 88,177,544 bp (GRCm38/mm10). This mutation deletes exon 3 and 307 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to result in a change in amino acid sequence after residue 114 and early truncation 1 amino acid later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Cuedc1 Mutation: 61 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)