Cuedc1em1(IMPC)J
Endonuclease-mediated Allele Detail
|
Symbol: |
Cuedc1em1(IMPC)J |
Name: |
CUE domain containing 1; endonuclease-mediated mutation 1, Jackson |
MGI ID: |
MGI:5763461 |
Synonyms: |
Cuedc1em1J |
Gene: |
Cuedc1 Location: Chr11:87989972-88084966 bp, + strand Genetic Position: Chr11, 52.4 cM
|
Alliance: |
Cuedc1em1(IMPC)J page
|
IMPC: |
Cuedc1 gene page |
|
Strain of Origin: |
C57BL/6NJ
|
Project Collection: |
IMPC
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutation: |
|
Intragenic deletion
|
|
|
Mutation details: This allele from project Cuedc1-7438J-M5795 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences AAACTCCTAGGACACGTCCT, ACCTAAGGCCAGCATCGCCA, ATTTTTGTCTCAGAGCGCAG and GTGGCAAGAGACATTTTCAC, which resulted in a 435 bp deletion spanning ENSMUSE00001255541 (exon 3) beginning at Chromosome 11 positive strand position 88,177,110 bp, GCCAAGGAGTAGCTCCTAGC, and ending after TGTGGCAAGAGACATTTTCAC at 88,177,544 bp (GRCm38/mm10). This mutation deletes exon 3 and 307 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to result in a change in amino acid sequence after residue 114 and early truncation 1 amino acid later.
(J:188991)
|
Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
All: |
2 reference(s) |
|