Tmcc3em1(IMPC)J
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Tmcc3em1(IMPC)J |
| Name: |
transmembrane and coiled coil domains 3; endonuclease-mediated mutation 1, Jackson |
| MGI ID: |
MGI:5763283 |
| Synonyms: |
Tmcc3em1J |
| Gene: |
Tmcc3 Location: Chr10:94147811-94426818 bp, + strand Genetic Position: Chr10, 48.88 cM
|
| Alliance: |
Tmcc3em1(IMPC)J page
|
| IMPC: |
Tmcc3 gene page |
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele from project Tmcc3-7561J-M9674 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GCACAGGTGTTCCAACGGCG, CCCTGAATCCCAATTCTAGG, CCTGGAAAAATCCTACACCG and TTAGGCAACCGGGTAACAGA, which resulted in a 497 bp deletion spanning exon 3 beginning at Chromosome 10 positive strand position 94,582,088 bp, CCTAGAATTGGGATTCAGGG, and ending after CTGTTGGCTTATGTTCCCTCT at 94,582,584 bp (GRCm38/mm10), with 3 base pairs (CCG) retained in place of this deletion. This mutation deletes exon 3 and 361 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to result in a change in amino acid sequence after residue 332 and an early truncation after an additional 27 amino acids.
(J:188991, J:384794)
|
| Inheritance: |
|
Not Specified |
|
|
|
|
| Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
| All: |
3 reference(s) |
|