About   Help   FAQ
Tmcc3em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Tmcc3em1(IMPC)J
Name: transmembrane and coiled coil domains 3; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5763283
Synonyms: Tmcc3em1J
Gene: Tmcc3  Location: Chr10:94147811-94426818 bp, + strand  Genetic Position: Chr10, 48.88 cM
Alliance: Tmcc3em1(IMPC)J page
IMPC: Tmcc3 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Tmcc3-7561J-M9674 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GCACAGGTGTTCCAACGGCG, CCCTGAATCCCAATTCTAGG, CCTGGAAAAATCCTACACCG and TTAGGCAACCGGGTAACAGA, which resulted in a 497 bp deletion spanning exon 3 beginning at Chromosome 10 positive strand position 94,582,088 bp, CCTAGAATTGGGATTCAGGG, and ending after CTGTTGGCTTATGTTCCCTCT at 94,582,584 bp (GRCm38/mm10), with 3 base pairs (CCG) retained in place of this deletion. This mutation deletes exon 3 and 361 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to result in a change in amino acid sequence after residue 332 and an early truncation after an additional 27 amino acids. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Tmcc3 Mutation:  34 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/24/2026
MGI 6.24
The Jackson Laboratory