About   Help   FAQ
Bzw1em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Bzw1em1(IMPC)J
Name: basic leucine zipper and W2 domains 1; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5763137
Synonyms: Bzw1em1J
Gene: Bzw1  Location: Chr1:58432057-58446512 bp, + strand  Genetic Position: Chr1, 29.09 cM, cytoband C2
Alliance: Bzw1em1(IMPC)J page
IMPC: Bzw1 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Bzw1-7578J-M3933 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TATGTGGCTCAAAACTAGCG, ACGCACTGCTTTCTGCCGCC, GTGTGGGTCTTGGTGAAATA and ATATCACCCATATCGCTATA, which resulted in a 308 bp deletion spanning exon 4 beginning at Chromosome 1 positive strand position 58,398,906 bp, GCGCGGTAGCCCTGGCGGCA, and ending after AAGGGTGTGGGTCTTGGTGAA at 58,399,213 bp (GRCm38/mm10). This mutation deletes exon 4 and 213 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to result in a change of amino acid sequence after residue 112 and early truncation 2 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 2 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Bzw1 Mutation:  30 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
09/30/2025
MGI 6.24
The Jackson Laboratory