Tex2em1(IMPC)J
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Tex2em1(IMPC)J |
| Name: |
testis expressed gene 2; endonuclease-mediated mutation 1, Jackson |
| MGI ID: |
MGI:5763013 |
| Synonyms: |
Tex2em1J |
| Gene: |
Tex2 Location: Chr11:106392973-106504249 bp, - strand Genetic Position: Chr11, 69.46 cM, cytoband D
|
| Alliance: |
Tex2em1(IMPC)J page
|
| IMPC: |
Tex2 gene page |
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele from project Tex2-7559J-M9640 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GAGAATAATGACCTAAAGGC, TGAGTGTGCACCTGTTTAAA, TACAGTCAGATCATGACAGA and GGATACATTTCAGAGATGGC, which resulted in a 610 bp deletion spanning exon 4 beginning at Chromosome 11 positive strand position 106,546,571 bp, AGGCCGGCTTCCTGTCTGCC, and ending after TACATTTCAGAGATGGCTGG at 106,547,180 bp (GRCm38/mm10). This mutation deletes exon 4 and 270 bp of flanking intronic sequence including the splice acceptor and donor. This mutation is predicted to result in a change in amino acid sequence after residue 613 and an early truncation after an additional 15 amino acids.
(J:188991)
|
| Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
|
|
| Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
| All: |
3 reference(s) |
|