About   Help   FAQ
Tex2em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Tex2em1(IMPC)J
Name: testis expressed gene 2; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5763013
Synonyms: Tex2em1J
Gene: Tex2  Location: Chr11:106392973-106504249 bp, - strand  Genetic Position: Chr11, 69.46 cM, cytoband D
Alliance: Tex2em1(IMPC)J page
IMPC: Tex2 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Tex2-7559J-M9640 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GAGAATAATGACCTAAAGGC, TGAGTGTGCACCTGTTTAAA, TACAGTCAGATCATGACAGA and GGATACATTTCAGAGATGGC, which resulted in a 610 bp deletion spanning exon 4 beginning at Chromosome 11 positive strand position 106,546,571 bp, AGGCCGGCTTCCTGTCTGCC, and ending after TACATTTCAGAGATGGCTGG at 106,547,180 bp (GRCm38/mm10). This mutation deletes exon 4 and 270 bp of flanking intronic sequence including the splice acceptor and donor. This mutation is predicted to result in a change in amino acid sequence after residue 613 and an early truncation after an additional 15 amino acids. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 2 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Tex2 Mutation:  160 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/25/2025
MGI 6.24
The Jackson Laboratory