Tgfbr3lem1(IMPC)J
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Tgfbr3lem1(IMPC)J |
| Name: |
transforming growth factor, beta receptor III-like; endonuclease-mediated mutation 1, Jackson |
| MGI ID: |
MGI:5763011 |
| Synonyms: |
Tgfbr3lem1J |
| Gene: |
Tgfbr3l Location: Chr8:4298214-4301423 bp, + strand Genetic Position: Chr8, 1.99 cM
|
| Alliance: |
Tgfbr3lem1(IMPC)J page
|
| IMPC: |
Tgfbr3l gene page |
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele from project Tgfbr3l-7560J-F9665 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TTTGGCATGCGGCTGAGCAT, TAGGCCCTGATGCCACTAAG, GGCGCCTTAAACGACGAGGG and GCAGGATCAAGGCGCCATCA, which resulted in a 345 bp deletion spanning exon 2 beginning at Chromosome 8 positive strand position 4,249,063 bp, AAGCGGTACATGGTTGTAAC, and ending after GGGGACTGGTCGACCTTGAT, at 4,249,407 bp (GRCm38/mm10). This mutation deletes exon 2 and 208 bp of flanking intronic sequence including the splice acceptor and donor. This mutation is predicted to result in a change in amino acid sequence after residue 23 and a early truncation after an additional 55 amino acids.
(J:188991)
|
| Inheritance: |
|
Not Specified |
|
|
|
|
| Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
| All: |
2 reference(s) |
|