About   Help   FAQ
Tgfbr3lem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Tgfbr3lem1(IMPC)J
Name: transforming growth factor, beta receptor III-like; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5763011
Synonyms: Tgfbr3lem1J
Gene: Tgfbr3l  Location: Chr8:4298214-4301423 bp, + strand  Genetic Position: Chr8, 1.99 cM
Alliance: Tgfbr3lem1(IMPC)J page
IMPC: Tgfbr3l gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Tgfbr3l-7560J-F9665 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TTTGGCATGCGGCTGAGCAT, TAGGCCCTGATGCCACTAAG, GGCGCCTTAAACGACGAGGG and GCAGGATCAAGGCGCCATCA, which resulted in a 345 bp deletion spanning exon 2 beginning at Chromosome 8 positive strand position 4,249,063 bp, AAGCGGTACATGGTTGTAAC, and ending after GGGGACTGGTCGACCTTGAT, at 4,249,407 bp (GRCm38/mm10). This mutation deletes exon 2 and 208 bp of flanking intronic sequence including the splice acceptor and donor. This mutation is predicted to result in a change in amino acid sequence after residue 23 and a early truncation after an additional 55 amino acids. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Tgfbr3l Mutation:  20 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory