About   Help   FAQ
Ttc32em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Ttc32em1(IMPC)J
Name: tetratricopeptide repeat domain 32; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5763010
Synonyms: Ttc32em1J
Gene: Ttc32  Location: Chr12:9079997-9086394 bp, + strand  Genetic Position: Chr12, 3.98 cM, cytoband A1.3
Alliance: Ttc32em1(IMPC)J page
IMPC: Ttc32 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Ttc32- 7506J-M9214 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GCTACAACACGCTGTGTGGA, AGCCCCACGAAAGTCGCCGA, AGAGCGATCAGCTGTCGTGA and AGGTTTAGAGCTAAGGAACA, which resulted in a 489 bp deletion spanning exon 2 beginning at Chromosome 12 positive strand position 9,034,742 bp, GTCGCCGATGGTCTTCCACA, and ending after TTTAGAGCTAAGGAACAAGGAA at 9,035,230 bp (GRCm38/mm10). This mutation deletes exon 2 and 322 bp of flanking intronic sequence including the splice acceptor and donor. This mutation is predicted to result in a change in amino acid sequence after residue 46 and early truncation after an additional 3 amino acids. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Ttc32 Mutation:  9 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/30/2025
MGI 6.24
The Jackson Laboratory