About   Help   FAQ
Acot2em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Acot2em1(IMPC)J
Name: acyl-CoA thioesterase 2; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5763009
Synonyms: Acot2em1J
Gene: Acot2  Location: Chr12:84034635-84040647 bp, + strand  Genetic Position: Chr12, 38.99 cM, cytoband D3
Alliance: Acot2em1(IMPC)J page
IMPC: Acot2 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Acot2-7575J-M3846 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CTGGGTGCTTGAAGACCGGA, GGAAACTGTGGACTCAGCCC, CGTTGATGAGGAGATCTGAT, TATAGACTGTCTCCCAGACA, which resulted in a 378 bp deletion spanning exon 2 beginning at Chromosome 12 positive strand position 83,990,413 bp, CTTTATGATCAGTCTGAAAC, and ending after TTGTGGCAGCCCCTCCCTGT at 83,990,790 bp (GRCm38/mm10). This mutation deletes exon 2 and 175 bp of flanking intronic sequence including the splice acceptor and donor. There is also a 4 bp deletion in the 5-prime intron 16 bp before the exon deletion that will not affect the mutation. This mutation is predicted to result in a change in amino acid sequence after residue 193 and early truncation 15 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Acot2 Mutation:  18 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/18/2025
MGI 6.24
The Jackson Laboratory