About   Help   FAQ
Anks3em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Anks3em1(IMPC)J
Name: ankyrin repeat and sterile alpha motif domain containing 3; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5763008
Synonyms: Anks3em1J
Gene: Anks3  Location: Chr16:4759300-4782069 bp, - strand  Genetic Position: Chr16, 2.48 cM, cytoband A1
Alliance: Anks3em1(IMPC)J page
IMPC: Anks3 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Anks3-7436J-F5765 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TTGTCGAACTGAAGGCCTAG, CCAAAAACCCGGGTGCTCAC, ACTTACCTGGGGATGAATGG and TATACCCAGCATCTCACATG, which resulted in a 298 bp deletion spanning ENSMUSE00000292922 (exon 3) beginning at Chromosome 16 negative strand position 4,958,217 bp, AAGCCACATGTGAGATGCTG, and ending after GGTGCTCACTGGTTGCCTTG at 4,957,920 bp (GRCm38/mm10). This mutation deletes exon 3 and 99 bp of flanking intronic sequence including the splice acceptor and donor. There is an additional 10 bp deletion in the 5-prime intron, 68 before the exon deletion that will not affect the mutation. This mutation is predicted to result in a change in amino acid sequence after residue 57 and early truncation after an additional 6 amino acids. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Anks3 Mutation:  29 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/22/2025
MGI 6.24
The Jackson Laboratory