Tpd52l1^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Tpd52l1^em1(IMPC)J
• Name: tumor protein D52-like 1; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5755683
• Synonyms: Tpd52l1^em1J
• Gene: Tpd52l1 Location: Chr10:31208372-31321954 bp, - strand Genetic Position: Chr10, 17.36 cM, cytoband A4-B2
• Alliance: Tpd52l1^em1(IMPC)J page
• IMPC: Tpd52l1 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Tpd52l1-7503J-M9170 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CCAGAACTTGAGTTAAGTTA, ACCCGGAAGCGGAATCGGGG, CTTTGAAAAGTCAATCCGCG, and CATTCTTTAAGGTCACTCCG, which resulted in a 361 bp deletion spanning exon 3 beginning at Chromosome 10 negative strand position 31358175bp, ACTCCGTGGTGAGGTCACTT, and ending after TTCAGTCCCGCCCCGATTC at 31357815 bp (GRCm38/mm10). This mutation deletes exon 3 and 212 bp of flanking intronic sequence including the splice acceptor and donor. This mutation is predicted to result in a change in amino acid sequence after residue 45 and early truncation 20 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Tpd52l1 Mutation: 20 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)