About   Help   FAQ
Tpd52l1em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Tpd52l1em1(IMPC)J
Name: tumor protein D52-like 1; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5755683
Synonyms: Tpd52l1em1J
Gene: Tpd52l1  Location: Chr10:31208372-31321954 bp, - strand  Genetic Position: Chr10, 17.36 cM, cytoband A4-B2
Alliance: Tpd52l1em1(IMPC)J page
IMPC: Tpd52l1 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Tpd52l1-7503J-M9170 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CCAGAACTTGAGTTAAGTTA, ACCCGGAAGCGGAATCGGGG, CTTTGAAAAGTCAATCCGCG, and CATTCTTTAAGGTCACTCCG, which resulted in a 361 bp deletion spanning exon 3 beginning at Chromosome 10 negative strand position 31358175bp, ACTCCGTGGTGAGGTCACTT, and ending after TTCAGTCCCGCCCCGATTC at 31357815 bp (GRCm38/mm10). This mutation deletes exon 3 and 212 bp of flanking intronic sequence including the splice acceptor and donor. This mutation is predicted to result in a change in amino acid sequence after residue 45 and early truncation 20 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Tpd52l1 Mutation:  20 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory