About   Help   FAQ
Stard9em47Kvau
Endonuclease-mediated Allele Detail
Summary
Symbol: Stard9em47Kvau
Name: StAR related lipid transfer domain containing 9; endonuclease-mediated mutation 47, Kevin T Vaughan
MGI ID: MGI:5755658
Gene: Stard9  Location: Chr2:120459602-120562376 bp, + strand  Genetic Position: Chr2, 60.37 cM, cytoband F1
Alliance: Stard9em47Kvau page
Mutation
origin
Strain of Origin:  C57BL/6
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsCRISPR-targeting deleted a portion of the gene to generate a null allele. Line 47 5 end GTGGCCGTGAGGGTCCGGCCTCTCAG and 3 end ATGGCACCAGCCCAGGGTTGCCAGT. (J:336775)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Stard9 Mutation:  190 strains or lines available
References
Original:  J:336775 Sterling FR, et al., StARD9 is a novel lysosomal kinesin required for membrane tubulation, cholesterol transport and Purkinje cell survival. J Cell Sci. 2023 Mar 1;136(5):jcs260662
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/06/2026
MGI 6.24
The Jackson Laboratory