About   Help   FAQ
Rab12em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Rab12em1(IMPC)J
Name: RAB12, member RAS oncogene family; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5755652
Synonyms: Rab12em1J
Gene: Rab12  Location: Chr17:66801507-66826712 bp, - strand  Genetic Position: Chr17, 37.88 cM
Alliance: Rab12em1(IMPC)J page
IMPC: Rab12 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Rab12-7420J-M4534 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GTGCGCATCTCACTGTTAAA, TTTAACAGTGAGATGCGCAC, CGAGGTGCAGAAGTGCATAA, and CCAATCTTGTGCCCCCACCG, which resulted in a 264 bp deletion spanning exon 3 beginning at Chromosome 17 negative strand position 66,500,258 bp, TAAGGGTTTGCACTAGAAGA and ending after CCTGTGCGCATCTCACTGTT at 66,500,258 bp (GRCm38/mm10). This mutation deletes exon 3 and 125 bp of flanking intronic sequence including the splice acceptor and donor. This mutation is predicted to result in an amino acid sequence change after residue 94 and early truncation 35 amino acids later. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Rab12 Mutation:  19 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
04/30/2024
MGI 6.23
The Jackson Laboratory