About   Help   FAQ
Rab6bem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Rab6bem1(IMPC)J
Name: RAB6B, member RAS oncogene family; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5755647
Synonyms: Rab6bem1J
Gene: Rab6b  Location: Chr9:102988986-103062475 bp, + strand  Genetic Position: Chr9, 54.88 cM
Alliance: Rab6bem1(IMPC)J page
IMPC: Rab6b gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Rab6b-7421J-M4508 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GTAAGACCAGCCTATGGCTA, CTAGCCATAGGCTGGTCTTA, GCTCTCCAGACAGGGTCCAC, and AGGGAGCATTGAGCTCAGAG, which resulted in a 178 bp deletion spanning exon 2 beginning at Chromosome 9 positive strand position 103,140,328bp, CCTAGCCATAGGCTGGTCTT and ending after CTCTGTCTCTGCCTGTGGAC at 103,140,505 bp (GRCm38/mm10). This mutation deletes exon 2 and 119 bp of flanking intronic sequence including the splice acceptor and donor. This mutation is predicted to result in an amino acid sequence change after residue 23 and early truncation 5 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Rab6b Mutation:  20 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  4 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/29/2025
MGI 6.24
The Jackson Laboratory