About   Help   FAQ
Rab11fip3em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Rab11fip3em1(IMPC)J
Name: RAB11 family interacting protein 3 (class II); endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5755639
Synonyms: Rab11fip3em1J
Gene: Rab11fip3  Location: Chr17:26208010-26288529 bp, - strand  Genetic Position: Chr17, 13.05 cM
Alliance: Rab11fip3em1(IMPC)J page
IMPC: Rab11fip3 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Rab11fip3-7419J-M4978 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TCAGCTGGATGAAAGCACAC, GTGCAGCTCCACAAGCCAGC, CAGTCAGTAGGCAGCTATGG, and AACAAAAATAATAATCTCGA, which resulted in a 362 bp deletion spanning exon 4 beginning at Chromosome 17 negative strand position 26,016,187 bp, GCTGCCTACTGACTGTCCAT, and ending after TGTGGAGCTGCACCTGTGTG at 26,015,826 bp (GRCm38/mm10). This mutation deletes exon 4 and 150 bp of flanking intronic sequence including the splice acceptor and donor. This mutation is predicted to result in a change in amino acid sequence after residue 594 and early truncation 14 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Rab11fip3 Mutation:  49 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/22/2025
MGI 6.24
The Jackson Laboratory