Otogl^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Otogl^em1(IMPC)J
• Name: otogelin-like; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5755623
• Synonyms: Otogl^em1J
• Gene: Otogl Location: Chr10:107596392-107747995 bp, - strand Genetic Position: Chr10, 56.11 cM
• Alliance: Otogl^em1(IMPC)J page
• IMPC: Otogl gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Otogl-7415J-M363 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TTTCTGAGATGGTCCCTTGG, GAGATGGTCCCTTGGTGGTG, CCATGATCGAGACCGTCTCG, and CCCGAGACGGTCTCGATCAT, which resulted in a 270 bp deletion spanning exon 4 beginning at Chromosome 10 negative strand position 107,903,262 bp, CCCCGAGACGGTCTCGATCA, and ending after TGAGATGGTCCCTTGGTGGT at 107,902,993 bp (GRCm38/mm10). This mutation deletes exon 4 and 203 bp of flanking intronic sequence including the splice acceptor and donor. This mutation is predicted to result in an amino acid sequence change after residue 47 and early truncation 119 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Otogl Mutation: 137 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)